View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_low_24 (Length: 241)
Name: NF10385_low_24
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 33466445 - 33466666
Alignment:
| Q |
5 |
aatataaaggagatcataagtgcaattttacnnnnnnnaatctttgcattaatgattaatagaactgaaatatttcacatttcattatatgcagtttgct |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33466445 |
aatataaaggagataataagtgcaattttactttttttaatctttgcattaatgattaatagaactgaaatatttcacatttcattatatgcagtttgct |
33466544 |
T |
 |
| Q |
105 |
tcgtcggagatgatgatcatgaggaaaatacacatgcatgtaggatttcacatagtcattttcacaatgtgcttcatgtagaagcatgataaccaaattt |
204 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33466545 |
ttgtaggagatgatgatcatgaggaaaatacacatgcatgtaggatttcacatagtcattttcacaatgtgcttcatgtagaagcatgataaccaaattt |
33466644 |
T |
 |
| Q |
205 |
tgttgcaaaaaatgagaaaaat |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33466645 |
tgttgcaaaaaatgagaaaaat |
33466666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University