View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_low_25 (Length: 239)
Name: NF10385_low_25
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 43769609 - 43769401
Alignment:
| Q |
12 |
cacagattgaataccagtaatgtccgcaggtgcatataccaccattgactcgtaagaatttgtgcagctatcttgcagtatccacatattgttttcttta |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43769609 |
cacagattgaataccagtaatatccgcaggtgcatataccaccattgactcgtaagaatttgtgcagctatcttgcagtatccacatattgttttctttt |
43769510 |
T |
|
| Q |
112 |
gatttaattgtctataaagggagaagnnnnnnncttcttatttttcttagaagttagaaaatgtttcaaatgtaacttgcattttgttcagtatgttaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43769509 |
gatttaattgtctataaagggagaagaaaaaaacctcttatttttcttggaagttagaaaatgtttcaaatgtaacttgcattttgttcagtatgttaag |
43769410 |
T |
|
| Q |
212 |
ttttgaata |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
43769409 |
ttttgaata |
43769401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 43779774 - 43779703
Alignment:
| Q |
149 |
ttatttttcttagaagttagaaaatgtttcaaatgtaacttgcattttgttcagtatgttaagttttgaata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
43779774 |
ttatttttcttagaagttagaaaatgttttaaatgtaacttgcattttgttcaatatgttcagttttgaata |
43779703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University