View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_high_13 (Length: 234)
Name: NF10386_high_13
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_high_13 |
 | |
|
| [»] scaffold0050 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 8365 - 8218
Alignment:
| Q |
15 |
atgaaataggtaggaatgcaaataaatgaaataatagttatggttttcaattaaagaagatttaagtcagaggttccaggtttgataaatgaaaactaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
8365 |
atgaaataggtaggaatgcaaataaatgaaataatagttatggttttcaat-aaagaagatttaagtcagaggttccagatttgatcaatgaaaactaac |
8267 |
T |
|
| Q |
115 |
attatccccttccctcgaacaacttactaacaattaacatttgcatatc |
163 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
8266 |
attatccccttcccttgaacaacttactaacaattaacatttgcctatc |
8218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 216
Target Start/End: Complemental strand, 8199 - 8165
Alignment:
| Q |
182 |
cataactaaggtgaaatgaatgagtggaagaaatt |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
8199 |
cataacaaaggtgaaatgaatgagtggaagaaatt |
8165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 29500739 - 29500631
Alignment:
| Q |
13 |
agatgaaataggtaggaatgcaaataaatgaaataatagttatggttttcaattaaagaagatttaagtcagaggttccaggtttgataaatgaaaacta |
112 |
Q |
| |
|
|||||||||| |||| || ||||||||| ||||||| ||||| ||| ||| |||| || ||| |||||| | |||||| ||||||| |||||||||| |
|
|
| T |
29500739 |
agatgaaatatgtagaaaggcaaataaagaaaataatggttattattt-caaataaaaaatattaaagtcacaagttccacgtttgatccatgaaaacta |
29500641 |
T |
|
| Q |
113 |
acattatccc |
122 |
Q |
| |
|
||||| |||| |
|
|
| T |
29500640 |
acattttccc |
29500631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University