View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_high_16 (Length: 220)
Name: NF10386_high_16
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 42089443 - 42089257
Alignment:
| Q |
20 |
taaatcttcgttctaaactaaatttattctagttgtatgagttagaaaagttatcatataaatttataattaggaatggagacaaatgcaattccttcat |
119 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42089443 |
taaatcttcgttctacactaaatttattctagttgtatgagttagaaaagttatcatataagtttataattaggaatggtgacaaatgcaattccttcat |
42089344 |
T |
 |
| Q |
120 |
taaaacacgtgtacagagcaacatttgactgagccatcaaactatgagtagaaagtgtctcttgtcctaattacattagccctttgct |
207 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089343 |
t-aaacacgtgtacagagcagcatttgactgagccatcaaactatgagtagaaagtgtctcttgtcctaattacattagccctttgct |
42089257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University