View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_low_12 (Length: 258)
Name: NF10386_low_12
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 26303415 - 26303179
Alignment:
| Q |
1 |
ataatcttagtgctttataatgttccactcatgtatactagaaatctatgattatttccaacagtaaagttcaataagaaatgttgactaaaataataat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26303415 |
ataatcttagtgctttataatgttccactcatgtatactagaaatctatgattatttccaacagtaaagttcaataagaaatgttcactaaaataataat |
26303316 |
T |
|
| Q |
101 |
tgtgatgaacaatatattttggctgctccacttcactcaagcaatatgatccatgcatgtgtggcatgactgctactgccacagtgtcagcaggacgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26303315 |
tgtgatgaacaatatattttggctgctccacttcactcaagcaatatgatccatgcatgtgtggcatgactgctactgccacagtgtcagcaagacgatg |
26303216 |
T |
|
| Q |
201 |
gatgctatactttgatgattcatttgccaaaagatct |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26303215 |
gatgctatactttgatgattcatttgacaaaagatct |
26303179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University