View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_low_15 (Length: 248)
Name: NF10386_low_15
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 151
Target Start/End: Original strand, 48289852 - 48289983
Alignment:
| Q |
23 |
aagatcctccaacctcttgcagcgctggtaattcnnnnnnn---gtcttccctccaaccccattttatgctttaaacacccctcatgcttggatctatga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289852 |
aagatcctccaacctcttgcagcgctggtaattttattttttttgtcttccctccaaccccattttatgctttaaacacccctcatgcttggatctatga |
48289951 |
T |
 |
| Q |
120 |
atttttcacttttatctatatgggtattcatc |
151 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
48289952 |
atttttcacttttatctttatgggtattcatc |
48289983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University