View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_low_5 (Length: 392)
Name: NF10386_low_5
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 267
Target Start/End: Original strand, 42913241 - 42913492
Alignment:
| Q |
19 |
catcacatcacccatacatttagctactggtagtaagtactatagctattttattacaccactaaacaagtaacaagaagaagacatt---caacaagac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
42913241 |
catcacatcacccatacatttagctactagtagtaagtactatagctattttattacaccactaaacaagtaacaagaaaaagacattaaacaacaagac |
42913340 |
T |
 |
| Q |
116 |
ataatgaaacttaacttaaagtgattaatgtaattaaccactctctctaattaaacacttccataaacttcacacattttctccttattcactcttctca |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42913341 |
atagtgaaacttaacttaaagtgattaatgtaattaaccactctctctaattaaacacttccataaacttcacacattttctccttattcactcttctca |
42913440 |
T |
 |
| Q |
216 |
attggagcctcttcttcattcttctcaatttttgcatcattgttggtgatca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42913441 |
attggagcctcttcttcattcttctcaatttttgcatcattgttggtgatca |
42913492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University