View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10386_low_8 (Length: 355)
Name: NF10386_low_8
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10386_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 32869029 - 32868768
Alignment:
| Q |
1 |
gatggcggacgtcttggtagaaaagcattagaccgcgatagaaaagcacaaggcagatgtccttgttgcggtaatggtcacaatcacaacacaaaatcag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32869029 |
gatggcagacgtcttggtagaaaagcattagaccgcgatagaaaaggacgaggcagatgtccttgttgcggtaatggtcacaatcacaacacaaaataag |
32868930 |
T |
|
| Q |
101 |
catcagataaacaaggtttgctataatttgaaactcgcaaatctatagataataataaaagcaagctttgtattatagcaagtatgacatttgccgtcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
32868929 |
catcagataaacaaggtttgctataatttgaaactcgcaaatctatagataataat-aaagcaagcttagtattatagcaagtatgacatttgtcgtcta |
32868831 |
T |
|
| Q |
201 |
attaaagtgtttactttttctaatctttctattttggcgttgaatattgactttagttttctt |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
32868830 |
attagagtgtttactttttctaatctttctattttggtgttgaatattgacattggttttctt |
32868768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 32868773 - 32868723
Alignment:
| Q |
289 |
tttcttcaattttttgggacgcatcttaactgaaatctggtatcttcctat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32868773 |
tttcttcaattttttgggacgcatcttaactgaaatctggtatcttcctat |
32868723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 144 - 193
Target Start/End: Complemental strand, 7964565 - 7964517
Alignment:
| Q |
144 |
tatagataataataaaagcaagctttgtattatagcaagtatgacatttg |
193 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
7964565 |
tatagataataataaa-gcaagcttagtattatggcaagtatgacatttg |
7964517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University