View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10387_high_1 (Length: 240)
Name: NF10387_high_1
Description: NF10387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10387_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1780564 - 1780787
Alignment:
| Q |
1 |
tttgtattggtaaaaacaattttttgacttataaaatattgaatgcacgatttttaagacaactttactatattaagttcgttaacatatgcccttaggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1780564 |
tttgtattggtaaaaacaattttttgacttataaaatattgaatgcaagatttttaagacaactttactatattaagttcgttaacatatgcccttaggg |
1780663 |
T |
|
| Q |
101 |
catgtgttagcattttcctataataaagtagactgnnnnnnnnnnnnnnnnnnngtgagcccccgttgaaacatgttgccatccctcataatgatgcaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1780664 |
catgtgttagcattttcctataataaagtagactgaaaaacaaaatgaaaaaaagtgagcccccgttgaaacatgttgccatccctcataatgatgcaat |
1780763 |
T |
|
| Q |
201 |
ttgttatgttccagactaaaaaac |
224 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
1780764 |
ttgttatgttccagactacaaaac |
1780787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 18050095 - 18050143
Alignment:
| Q |
169 |
aaacatgttgccatccctcataatgatgcaatttgttatgttccagact |
217 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18050095 |
aaacatgttaccatccctaataatgatgcaatttgttatgttccagact |
18050143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 99
Target Start/End: Complemental strand, 40560230 - 40560151
Alignment:
| Q |
20 |
ttttttgacttataaaatattgaatgcacgatttttaagacaactttactatattaagttcgttaacatatgcccttagg |
99 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||| ||| |||| |||||| |||| |||||| |
|
|
| T |
40560230 |
tttttttactttaaaaatattgaatgcacgatttttaagacaatattactacattgagttatttaacaaatgctcttagg |
40560151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University