View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10387_low_1 (Length: 388)
Name: NF10387_low_1
Description: NF10387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10387_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 128 - 304
Target Start/End: Complemental strand, 38838144 - 38837968
Alignment:
| Q |
128 |
gcttcacgatggcactcgaaaaacgatggcggcggctgacaaagaaaaccttaaaccttttggagattccgacggcacagtggtagagggtaaacgatag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
38838144 |
gcttcacgatggcactcgaaaaacgatggcggcggctgacaaagaaaaccttaaaccttttggagattctgacggcacagtggtagagggtaaacgatcg |
38838045 |
T |
|
| Q |
228 |
atcaaaaacgaatggtggtagtcaagaggnnnnnnncttcactttctctaagaacaacgatgtgaaggaagaagaaa |
304 |
Q |
| |
|
||||||||||||| |||||||| |||| | ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38838044 |
atcaaaaacgaatagtggtagtgaagaagtttttttcttcactctctctaagaacaacaatgtgaaggaagaagaaa |
38837968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University