View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10388_high_6 (Length: 248)
Name: NF10388_high_6
Description: NF10388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10388_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 238
Target Start/End: Original strand, 55356165 - 55356389
Alignment:
| Q |
8 |
gacatcatcaaatcaggggagaatttcaggatttctacgactaccaaaatgcctgaacagggaatttgtgaacgctgtggttatatttctagtcaggtat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356165 |
gacatcatcaaatcaggggagaatttcaggatttctacgaccaccaaaatgcctgaacagggattttgtgaacgctgtggttatatttctagtcaggtat |
55356264 |
T |
|
| Q |
108 |
ttttctcattatccatccctaaaacttggtttcatattatattattttatacaatacaatgctgctttccatccaaattgaacatttcttgctttcatac |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356265 |
ttttctcatta-ccatccctaaaacttggtttcatattata-----ttatacaatacaatgctgctttccatccaaattgaacatttcttgctttcatac |
55356358 |
T |
|
| Q |
208 |
cactataaacaggcttatcttatgtcctttg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55356359 |
cactataaacaggcttatcttatgtcctttg |
55356389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University