View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10388_low_12 (Length: 237)
Name: NF10388_low_12
Description: NF10388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10388_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 41398321 - 41398129
Alignment:
| Q |
1 |
aggtgtttaatgtggtatgaaaattatccatggcatgtgaagattagagatggatggaaggaattcgctgcagcaagcaagtttgtgaaaggagaccgga |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||| ||||||||||| | || |
|
|
| T |
41398321 |
aggtgtttaatttggtatgaagattatccatggcatgtgaagattaaagatggatgaaaggagtttgctgcaacaagcaagttggtgaaaggagaacaga |
41398222 |
T |
|
| Q |
101 |
tcatcttcaacattgttaatattaattttaacaatgagattaaggtgatgaaagaaagttatttatttgaagaggatgctggtgcctttttgg |
193 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| || || ||||||||||| |||||||||||||| |
|
|
| T |
41398221 |
tcatcttcaacattgttaacatcaattataacaatgagattaaggtgatgaaagaaagctacacatatgaagaggatgatggtgcctttttgg |
41398129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University