View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10388_low_14 (Length: 229)
Name: NF10388_low_14
Description: NF10388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10388_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 9467702 - 9467480
Alignment:
| Q |
7 |
tacttgaccgcaatttttcatcaaattttccttttaaggattatcatagctatgaatttcctcgacaattcgatgttagtttcttcaattgttcttcagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9467702 |
tacttgaccgcaatttttcatcaaattttccttttaaggattatcatagctatgaatttcctcgacaattcgatgttagtttcttcaattgttcttcagt |
9467603 |
T |
|
| Q |
107 |
agtacaactgatcaggagcagtaatctaatgcaacatcacggaacacaagacatcatatcttgcccaatttatgtcgttgattcagatcaagaagctatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9467602 |
agtacaactgatcaggagcagtaatctaatgcaacatcacggaacacaagacatcatatcttgcccaatttatgtcgttgattcagatcaagaaactatc |
9467503 |
T |
|
| Q |
207 |
gttgaatctgacgtattagtata |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9467502 |
gttgaatctgacgtattagtata |
9467480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University