View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_high_14 (Length: 249)
Name: NF10389_high_14
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 2323707 - 2323474
Alignment:
| Q |
1 |
cattaaattatttttcattaatttgcgtacattatcttttaccatatttaacaaatcacccacaaattatcaagttttgatgttagaaaattggctgcta |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
2323707 |
cattaaattatttttcatcaatttgcgtacattatcttgcaccatatttatcaaatcacacacaaattatcaagttttgatgtcataaaattggctgcta |
2323608 |
T |
 |
| Q |
101 |
tagtgttacgtcatatatagctgtgtaatcaaaaacattgaacaagattattcttttatcatactcttttatttattattatgagacttgacaaaacgat |
200 |
Q |
| |
|
||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2323607 |
tagtgttacgtcata----gcagtgtaat-aaaaacattgaacaagattattcttttatcatactcttttatttattattatgagacttgacaaaacgat |
2323513 |
T |
 |
| Q |
201 |
ggtagtgttaggcaaattcatttacttcttctccctttg |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2323512 |
ggtagtgttaggaaaattcatttacttcttctccgtttg |
2323474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University