View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_high_2 (Length: 443)
Name: NF10389_high_2
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 2e-87; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 20 - 261
Target Start/End: Complemental strand, 26225500 - 26225271
Alignment:
| Q |
20 |
tttttaagcaattttaaattataatggtgcaattatcacgtatgcacaaaacaatcaatagagttataaattataatggaagaataaggtaaagtaacaa |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225500 |
tttttaagcgattttaaattataatggtgcaattatcacgtatgcacaaa-caatcaatagagttataaattataatggaagaataaggtaaagtaacac |
26225402 |
T |
 |
| Q |
120 |
cgaaataaaggaattcattaggaatgcatttagtcttctagcaaacaaataagaaatgataatagattctttctttcttttttaagcaaaagatgggatg |
219 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
26225401 |
cgaaataaaggaat-----------gcatttcgtcttctagcaaacaaataagaaatgataatatattcttttttttttttttaaacaaaagatgggatg |
26225313 |
T |
 |
| Q |
220 |
cagaggggtcttatgctgcagaacccaaatcatatattaagc |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26225312 |
cagaggggtctcatgctgcagaacccaaatcatatattaagc |
26225271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 359 - 432
Target Start/End: Complemental strand, 26225171 - 26225098
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttctt |
432 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26225171 |
taatgaggtgaacgacttgaggcacccaccttgaatccttttcccgtctcaggttgcttcttcttgagtttctt |
26225098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 183 - 259
Target Start/End: Original strand, 41799075 - 41799151
Alignment:
| Q |
183 |
agattctttctttcttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatattaa |
259 |
Q |
| |
|
||||| ||| ||| |||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
41799075 |
agattttttttttattttttaagcaaaagatgggatgcagaggggtctcctgctgcagtacccaaaacatatattaa |
41799151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 30353210 - 30353285
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttcttct |
434 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| |||| |||||| |||||| |||||||||| |||||||| |
|
|
| T |
30353210 |
taatgaggcgagcgactcgaggcacccaccttgaatcctttttccgtctcaggttgtttcttcttgaatttcttct |
30353285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 41799251 - 41799326
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttcttct |
434 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||| | | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
41799251 |
taatgaggcgaacggctggaagcacccaccttgaatcctctgcccgtctcaggttgcttcttcttgagtttcttct |
41799326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 197 - 259
Target Start/End: Original strand, 30353029 - 30353091
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatattaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
30353029 |
ttttttaagcaaaagatgggatgcagcggggtctcctcctgtagaacccaaatcatatattaa |
30353091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 197 - 230
Target Start/End: Original strand, 49393340 - 49393373
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtct |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
49393340 |
ttttttaagcaaaagaagggatgcagaggggtct |
49393373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 197 - 259
Target Start/End: Complemental strand, 33871968 - 33871906
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatattaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
33871968 |
ttttttaagcaaaagatgggatgcagaggggtctcctgctgcagtacccaaaacatatattaa |
33871906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 197 - 259
Target Start/End: Original strand, 53485773 - 53485835
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatattaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
53485773 |
ttttttaagcaaaagatgggatgcagaggggtctcctgctgcagtacccaaaacatatattaa |
53485835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 42110236 - 42110311
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttcttct |
434 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||| | | |||| || |||||||||||||||||||||||||| |
|
|
| T |
42110236 |
taatgaggcgaacggctggaagcacccaccttgaatcctctgcccgcctcaggttgcttcttcttgagtttcttct |
42110311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 197 - 256
Target Start/End: Original strand, 29599246 - 29599305
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatat |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||| ||||||||||||| |||||||||| |
|
|
| T |
29599246 |
ttttttaagcaaaagaagggatgcagagcgatctcctgctgcagaaccctaatcatatat |
29599305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 197 - 256
Target Start/End: Original strand, 54035531 - 54035590
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatat |
256 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
54035531 |
ttttttaagtaaaagaaggggtgcagaggggtctcttgctgcagaaccctaatcatatat |
54035590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 198 - 256
Target Start/End: Original strand, 6779528 - 6779586
Alignment:
| Q |
198 |
tttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatat |
256 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| ||||| ||||||| |||||||||| |
|
|
| T |
6779528 |
tttttaagcaaaagaagggatgcagagggatctcctgctgtagaaccctaatcatatat |
6779586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 197 - 259
Target Start/End: Original strand, 42110075 - 42110137
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatattaa |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| |||||||| ||||||| |||||||||| |
|
|
| T |
42110075 |
ttttttaattaaaagatgggatgcagaggagtctcctgctgcagtacccaaaacatatattaa |
42110137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 88
Target Start/End: Original strand, 5430275 - 5430323
Alignment:
| Q |
40 |
ataatggtgcaattatcacgtatgcacaaaacaatcaatagagttataa |
88 |
Q |
| |
|
|||||||||||||| || | ||| ||||||||||||||| ||||||||| |
|
|
| T |
5430275 |
ataatggtgcaattttcccatatacacaaaacaatcaatggagttataa |
5430323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 197 - 254
Target Start/End: Complemental strand, 28431096 - 28431039
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
28431096 |
ttttttaagcaaaagatgggatgcagagggatctcctgctgcagaacccaaaacatat |
28431039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Complemental strand, 28430937 - 28430862
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttcttct |
434 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||| | | |||| || |||||||||||||||||||||||||| |
|
|
| T |
28430937 |
taatgaggcgaacggctggaagcacccaccttgaatcctctgcccgcctcaggttgcttcttcttgagtttcttct |
28430862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 197 - 256
Target Start/End: Original strand, 45135035 - 45135094
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatat |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| ||||||||||||| ||| |||||| |
|
|
| T |
45135035 |
ttttttaagcaaaagaagggatgcagagggatctcctgctgcagaaccctaattatatat |
45135094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 7517713 - 7517788
Alignment:
| Q |
359 |
taatgaggcgaacgactcgaggcacccactttgaatctttttcccgtctgaggttgcttcttcttgagtttcttct |
434 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||||| ||| | || || |||||||||||||||| ||||||||| |
|
|
| T |
7517713 |
taatgaggcgaacggcttgaggcacccaccttgaatcctttgctcgcctcaggttgcttcttcttgtgtttcttct |
7517788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 191 - 228
Target Start/End: Complemental strand, 31051982 - 31051945
Alignment:
| Q |
191 |
tctttcttttttaagcaaaagatgggatgcagaggggt |
228 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31051982 |
tcttttttttttaagcaaaaaatgggatgcagaggggt |
31051945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 197 - 256
Target Start/End: Original strand, 973362 - 973421
Alignment:
| Q |
197 |
ttttttaagcaaaagatgggatgcagaggggtcttatgctgcagaacccaaatcatatat |
256 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||| ||||||||||||| |||||||||| |
|
|
| T |
973362 |
ttttttaagcaaaagaaaggatgcagatggatctcctgctgcagaaccctaatcatatat |
973421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University