View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_1 (Length: 613)
Name: NF10389_low_1
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 127 - 472
Target Start/End: Original strand, 54147030 - 54147373
Alignment:
| Q |
127 |
atttggctgttctaattgttctgtcaacatttgggaaatttgtgagtgttcgtgattaggcttttctttgttctagtcaatccttttgttcgtccatgac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54147030 |
atttggctgttctaattgttctgtcaacatttgggaaatttgtgagtgttcgtaattaggcttttctttgttctagtcaatccttttgttcgtccatgac |
54147129 |
T |
|
| Q |
227 |
tattcaatatggtttgtttcttctttttctcatttaatttgctggtcaaaattagttcctatttgttgattagcatgttgcttttttgttttgattggga |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54147130 |
tattcaatatggtttgtttcttctttttctcatttaatttgctggtcaaaattagttcctattggttgattagcatgttgc--ttttgttttgattggga |
54147227 |
T |
|
| Q |
327 |
gaccgataaatttctaatggtgaaggtagtgtacctaagcataaattggttttttggtgcttgggagttagtaggcttcattgttgtgataacatggcat |
426 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54147228 |
gaccgataaatttataatggtgaaggtagtgtacctaagcataaattggttttttagtgcttgggagttagtaggcttcattgttgtgataacatggcat |
54147327 |
T |
|
| Q |
427 |
tggtaactagtcttctcaatgtctgcaaaattgtgttggtctatga |
472 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54147328 |
tggtaactagtcttctcaatgtctacaaaattgtgttggtctatga |
54147373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 54146920 - 54146964
Alignment:
| Q |
17 |
cctctttatgctgcttgcttttacggtatgttggcttcttggtta |
61 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54146920 |
cctctttatgttgcttgcttttacggtatgttggcttcttggtta |
54146964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 390 - 460
Target Start/End: Complemental strand, 24487524 - 24487454
Alignment:
| Q |
390 |
ggagttagtaggcttcattgttgtgataacatggcattggtaactagtcttctcaatgtctgcaaaattgt |
460 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| ||| ||| ||||||||||| |||||| |||||||| |
|
|
| T |
24487524 |
ggagttagtaggcttctttgttgtggcaacatgatatttgtatctagtcttctcgttgtctgtaaaattgt |
24487454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 354
Target Start/End: Complemental strand, 24487600 - 24487555
Alignment:
| Q |
310 |
ttttgttttgattgggagaccgata-aatttctaatggtgaaggta |
354 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
24487600 |
ttttgttttgattgggagaccgatagaatatctagtggtgaaggta |
24487555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University