View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_15 (Length: 301)
Name: NF10389_low_15
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 133 - 288
Target Start/End: Original strand, 35720356 - 35720515
Alignment:
| Q |
133 |
gggagaagagcatttttcgccactcaa-ttgagaggaaacccagatgagcttagtcatttggcaatgcattnnnnnnnnnnn---ctcctacagtaccca |
228 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35720356 |
gggagaagagcttttttcgccactcaaattgagaggaaacccagatgagcttagtcatttggcaatgcattaaaaaaaaaaaatactcctacagtaccca |
35720455 |
T |
|
| Q |
229 |
taatttactgaatgcaacacagtaatgctgttgctaactctccatctactccctttgctt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720456 |
taatttactgaatgcaacacagtaatgctgttgctaactctccatctactccctttgctt |
35720515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University