View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_21 (Length: 250)
Name: NF10389_low_21
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 53853309 - 53853075
Alignment:
| Q |
1 |
aagtacaagcttacgtggtactaaaaattttatggtgatcaagctctttacgtggcaaacaaaaacaagtcagctggcaactgagattacttggtttgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53853309 |
aagtacaagcttacgtggtactaaaaaatttatggtgatcaagctctttacgtggcaaacaaaaacaagtcagcttgcaactgagattacttggtttgct |
53853210 |
T |
 |
| Q |
101 |
cttcaactaggagaccaaattgtgatatgttattcttcattattatatcctaaattcaaagtggaagttgagaggagcatggccacgtatgcataacagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53853209 |
cttcaactaggagaccaaattgtgatatgttattcttcattattatatcctaaattcaaagtggaagttgagaggagcatggccacgtatgcataacagg |
53853110 |
T |
 |
| Q |
201 |
gcatggcattacaacaacgccattatctttattct |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
53853109 |
gcatggcattacaacaacaccattatctttattct |
53853075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University