View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_25 (Length: 238)
Name: NF10389_low_25
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 113 - 223
Target Start/End: Complemental strand, 26414407 - 26414297
Alignment:
| Q |
113 |
gtccatattccatatatcctacaaaatccgactttggtatcatgctaaattaacttagatctcactctcattaactaggaaaacattgcacaactcgaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414407 |
gtccatattccatatatcctacaaaatccgactttggtatcatgctaaattaacttagatctcactctcattaactaggaaaacattgcacaactcgaaa |
26414308 |
T |
 |
| Q |
213 |
acattgggaat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
26414307 |
acattgggaat |
26414297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 26414832 - 26414742
Alignment:
| Q |
1 |
atatcaacttaatattgttaaaatggtattttctctttcaaaatactatgatattgtgcgattcaaaatacttcttcaatgcctaccatcacac |
94 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414832 |
atatcaacttaat---gttaaaatggtattttctctttcaaaatactatgatattgtgcgattcaaaatacttcttcaatgcctaccatcacac |
26414742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University