View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_26 (Length: 237)
Name: NF10389_low_26
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 27 - 201
Target Start/End: Complemental strand, 32724632 - 32724461
Alignment:
| Q |
27 |
actatttctggaattaattttaaaaaacagatagaaggaatgaacgtagtggtgaaagtaaatgttatattatgaatattattcatgaatgaattttgaa |
126 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
32724632 |
actatttctgaaattaattt-aaaaaacagatagaaggaatgaacgtagtggtgaaagtaaatgttgtatcatgaatattattcatgaaagaattttgaa |
32724534 |
T |
|
| Q |
127 |
agagaaagatattaaaattaaaatttagaaacatacttggcaatgtcttctttcctcttctgtaagtgatttcac |
201 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
32724533 |
aga-aacgatattaaaattaaaatttagaaacatacttggcaatg-attttttcctcttctgtaagtgatttcac |
32724461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 81 - 201
Target Start/End: Complemental strand, 4001937 - 4001817
Alignment:
| Q |
81 |
aaagtaaatgttatattatgaatattattcatgaatgaattttgaaagagaaagatattaaaattaaaatttagaaacatacttggcaatgtcttctttc |
180 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4001937 |
aaagtaaatgttgtattatgaatattattcatgaatgaattttgaaagagaaagatattaaaattaaaatttagaaacatacttggcattgtcttctttc |
4001838 |
T |
|
| Q |
181 |
ctcttctgtaagtgatttcac |
201 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
4001837 |
ctcttatgtaagtgatttcac |
4001817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University