View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10389_low_27 (Length: 232)
Name: NF10389_low_27
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10389_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 52722864 - 52723068
Alignment:
| Q |
11 |
gagatgaagaatgagtgagtatacatgaggtgtttatccctatttat-aatagtttcaaacttcgagttgtactaagattgaagtcttatataaagagtt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
52722864 |
gagatgtagaatgagtgagtatacatgagatgtttatccctatttattaatagtttcaaacttcgaattgtactaagattgaaatcttatataaagagtt |
52722963 |
T |
|
| Q |
110 |
tttgtccatttgccggtgatgactactctttgttgtgggtctaatcttgatattgttttctcctaggtctaataattgaattttaggataggatgtcctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722964 |
tttgtccatttgccggtgatgactactctttgttgtgggtctaatctttatattgttttctcctaggtctaataattgaattttaggataggatgtcctt |
52723063 |
T |
|
| Q |
210 |
acgac |
214 |
Q |
| |
|
||||| |
|
|
| T |
52723064 |
acgac |
52723068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University