View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1038_low_10 (Length: 360)
Name: NF1038_low_10
Description: NF1038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1038_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 156 - 349
Target Start/End: Complemental strand, 26405383 - 26405188
Alignment:
| Q |
156 |
aaattagtttatcgaaattggtatcgaagaaaatcaaacctaaaatcttaagtgaatcatgtgaannnnnnnaagggacttttcatatcacttgtgacga |
255 |
Q |
| |
|
||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
26405383 |
aaattagttcatcgaaattgatatcaaagaaaatcaaacctaaaatcttaagtgaatcatgtgaatttttttaaggggcttttcatataacttgtgacga |
26405284 |
T |
 |
| Q |
256 |
ttttgtttttt--atctcatcttcctcatgaaaatagcgatcattcatctctatttcatcttctagtatgattcactaagtttcaatttctccttt |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
26405283 |
ttttgttttttttatcttatcttcctcatgaaagtagcgatcattcatctctatttcatcttccaggatgattcactaagtttcaatttctccttt |
26405188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 52 - 124
Target Start/End: Complemental strand, 26405478 - 26405406
Alignment:
| Q |
52 |
ataaattcacaagtttgatacttgcatgtgatgtagagaatatccttcctaagattcttggtcgaatcatgtg |
124 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26405478 |
ataaatttacaggtttgatacttgcatgtgatgtagagaatatccttcctaagattcttggtcgaatcatgtg |
26405406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 26412189 - 26412149
Alignment:
| Q |
12 |
tatattttttagacagtcttgtagttagttttttatgataa |
52 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26412189 |
tatattttttagacagtcttgcagttagttttttatgataa |
26412149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University