View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1038_low_16 (Length: 279)
Name: NF1038_low_16
Description: NF1038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1038_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 97 - 245
Target Start/End: Complemental strand, 32853259 - 32853111
Alignment:
| Q |
97 |
aggagtctcacattggatgtgagtgttggacaatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatca |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32853259 |
aggagtctcccattggatgtgagtgttggacaatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatca |
32853160 |
T |
|
| Q |
197 |
cttgtgtaattgctcttagtctaacctgattatcctgtgtttaaaggct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32853159 |
cttgtgtaattgctcttagtctaacctgattatcctgtgtttaaaggct |
32853111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University