View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1038_low_20 (Length: 251)
Name: NF1038_low_20
Description: NF1038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1038_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 49085400 - 49085162
Alignment:
| Q |
1 |
aaaatatttctagagtggttcttctcaaaagtagtgatagcatggtggttgtagtacctttttgtcatagcatctgtcttttcgcttcagtcgaaacttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085400 |
aaaatatttctagagtggttcttctcaaaagtagtgatagcatggtggttgcagtacctttttgtcatagcatctgtcttttcgcttcagtcgaaacttt |
49085301 |
T |
|
| Q |
101 |
gttagagctgcttctctttggctagtgcgatgagaactcgtgtctctaagcccgtcgtggtgatcgttattcatagaactttcaaggttgttcttgccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085300 |
gttagagctgcttctctttggctagtgcgatgagaactcgtgtctctaagcccgtcatggtgatcgttattcatagaactttcaaggttgttcttgccta |
49085201 |
T |
|
| Q |
201 |
caatagttgaaggggcatttccatcacttacgctgccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085200 |
caatagttgaaggggcatttccatcacttacgctgccta |
49085162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 52 - 136
Target Start/End: Original strand, 8896805 - 8896889
Alignment:
| Q |
52 |
tagtacctttttgtcatagcatctgtcttttcgcttcagtcgaaactttgttagagctgcttctctttggctagtgcgatgagaa |
136 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||| | |||||||||||||||||||||||||||||| | || |||||||||| |
|
|
| T |
8896805 |
tagtacctttttctcgaagcatctctcttttcgctttaatcgaaactttgttagagctgcttctctttgacgagagcgatgagaa |
8896889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University