View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10390_high_11 (Length: 268)
Name: NF10390_high_11
Description: NF10390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10390_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 31 - 252
Target Start/End: Complemental strand, 40043516 - 40043295
Alignment:
| Q |
31 |
aaatattgattgcattattaaggccaaatgataccatttatatatgcaatcgcaaacctaattattcggttatctatgtgtttaatgatttctatagttg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043516 |
aaatattgattgcattattaaggccaaatgataccatttatatatgcaatcgcaaacctaattattcggttatctatgtgtttaatgatttctatagttg |
40043417 |
T |
|
| Q |
131 |
acgaatttgtgatttgatttcaagaaacaaatgattattaaccctaattttggaaattgatctaagacaaatgttcaatccataaaattaatgttttgga |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043416 |
acgaatttgtgatttgattttaagaaacaaatgattattaaccctaattttggaaattgatcaaagacaaatgttcaatccataaaattaatgttttgga |
40043317 |
T |
|
| Q |
231 |
aattgatctatgtgttttcact |
252 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40043316 |
aattgatctatgtgttttcact |
40043295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University