View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_high_13 (Length: 240)
Name: NF10391_high_13
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 103 - 224
Target Start/End: Complemental strand, 42432459 - 42432338
Alignment:
| Q |
103 |
gaaaccaagcatattatgagcaataacattcttcaaatacccaagtcgggttttacggggaaaacgattcatcaaccattgggtgtttgcacacgtacaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432459 |
gaaaccaagcatattatgagcaataacattcttcaaatacccaagtcgggttttacggggaaaacgattcatcaaccattgggtgtttgcacacgtacaa |
42432360 |
T |
|
| Q |
203 |
caatttcaagccgtacgaacat |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42432359 |
caatttcaagccgtacgaacat |
42432338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University