View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_high_4 (Length: 417)
Name: NF10391_high_4
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 18 - 403
Target Start/End: Complemental strand, 10928215 - 10927828
Alignment:
| Q |
18 |
gaatctgtcagttgtacccaagcctctaggaagaagacaatatcatggacccaactttttaacgtgccaaataatagggacagaacaattgcagatgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
10928215 |
gaatctgtcagttgtacccaagcctctaggaaaaagacaatatcatggacccaactttttaatgtgccaaatagtagagacaaaacaaatgcagatgctt |
10928116 |
T |
 |
| Q |
118 |
ctggatcatatatcagttcagagtatccattacaaaatctctagaatcatgc----tgctgcagaacacgtacctttatgagtgtctcaaccacatcgac |
213 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10928115 |
ctggatcatatatc--ttcagagtatccgttacaaaatctctataatcatgcatgctgctgcagaacacgtacctttatgagtgtctcaaccacatctac |
10928018 |
T |
 |
| Q |
214 |
aaaccccctgcagcatgcggctacaagagcatgtacggcaatatgcggtcggatcaaatcagagctcatgagcaattccccacaccctgcttgcccatgg |
313 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10928017 |
aaaccccctgcagcatgcggccacaagagcatgtacagcaatatgcggtcggataaaatcagagctcatgagcaattccccacaccctgcttgcccatgg |
10927918 |
T |
 |
| Q |
314 |
taacttgcctccagaagagcttcttcacatgctggctgggatgcacctgcattaattaatgtctcaagaatatcaagatgaccctccctc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
10927917 |
taacttgcctccagaagagcttcttcacaagctagctgggatgcccctgcattaattaaggtctcaagaatatcaaggtgcccctccctc |
10927828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University