View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_high_5 (Length: 367)
Name: NF10391_high_5
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 352
Target Start/End: Complemental strand, 1573042 - 1572709
Alignment:
| Q |
19 |
aggtgggggctccaagattgggttatttgcatatttaatccaatcaaggagaagggggtcagataagttggccggatgagcaagattttgcacttgcaca |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573042 |
aggtgggggctctaagattgggttatttgcatatttaacccaatcaaggagaagggggtcagataagttggccggatgagcaagattttgcacttgcaca |
1572943 |
T |
|
| Q |
119 |
tagttgtctgtatcgcctgtataaagcattatgatttcgccatctggcaaaagcgtggcggatccggtccatacaccgttaatatcgaaccatttgtcgg |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1572942 |
tagttgtctgtatcgcctgtgtaaagcattatgacttcgccatctggcaaaagcgtggcggatccggtccatacaccgttaatatcgaaccatttgtcgg |
1572843 |
T |
|
| Q |
219 |
gttccatggcaatgggaaggtaaagccaatgaatcatgtccgttgatacagcatgaccccatgaaatgtttccccacacagctgaatcaggattgtattg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1572842 |
gttccatggcaatgggaaggtaaagccaatgaatcatgtccgatgatacagcatgaccccatgaaatgtttccccacacagctgaatcaggattgtattg |
1572743 |
T |
|
| Q |
319 |
gtaaaataaatggtaccatcccatgtgaaacaat |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1572742 |
gtaaaataaatggtaccatcccatgtgaaacaat |
1572709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University