View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_low_14 (Length: 317)
Name: NF10391_low_14
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 113 - 294
Target Start/End: Original strand, 9394893 - 9395074
Alignment:
| Q |
113 |
tttgaaaagaattcttaagtatatccttgatgtgggtgaatctagtcaagcaattgccagctaaaattctttcttgttgaaaaatgaatgatcataatga |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394893 |
tttgaaaagaattcttaaggatatccttgatgtgggtgaatctaatcaagcaattgccagctaaaattctttcttgttgaaaaatgaatgatcataatgc |
9394992 |
T |
|
| Q |
213 |
gcttgtttgtatccctaagctatgagtaattaggtgagcctttcatagcactttatactagactgcataataaagaaggttc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394993 |
gcttgtttgtatccctaagctatgagtaattaggtcagcctttcatagcactttatactagactgcataataaagaaggttc |
9395074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 9394758 - 9394871
Alignment:
| Q |
1 |
ttgataggtttgtagctcaaatgttcactatcagtcaagaaatatacacattattttctctaacaaagccaaatgatcttctctgatcttgaaacttagg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
9394758 |
ttgataggtttgtagctcaaatattcactatcagtcaagaaatatacacattattttctctaacaaagcgaaatgatcttctctgatcttggaacttagg |
9394857 |
T |
|
| Q |
101 |
gctaaggaatactt |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9394858 |
gctaaggaatactt |
9394871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University