View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_low_16 (Length: 267)
Name: NF10391_low_16
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 147 - 267
Target Start/End: Original strand, 19441922 - 19442042
Alignment:
| Q |
147 |
ttcataagacattaaaattaactttgttggcttgatccatgtggctgtgatgaggtgctgacgtttctttgacatggaaagatgtttcttggcaaatacg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19441922 |
ttcataagacattaaaattaactttgttggtttgatccatgtggctgtgatgaggtgctgacgtttctttgacatggaaagatgtttcttggcgaatacg |
19442021 |
T |
|
| Q |
247 |
aaatcatctgagattagagca |
267 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19442022 |
aaatcatctgagattagagca |
19442042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University