View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_low_18 (Length: 254)
Name: NF10391_low_18
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 37710429 - 37710213
Alignment:
| Q |
15 |
aagggcaacgtggtcctcatcatgtggatttggttgctccaatcctaggattatgaccaaacagcaggttgtctttcctcttttttagactagtt---at |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37710429 |
aagggcaacgtggtcctcatcatgtggatttggttgctccaatcctaggattatgaccaaacagcaggttgtctttcctcttttttagactagttgttat |
37710330 |
T |
 |
| Q |
112 |
gcccttgcgtagggtggttctagaagatgctcaaaggctataaacctagagagccctttctttttagttgcatgccattttctgctgatcaactcaacat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37710329 |
gcccttgcgtagggtggttctagaagatgctcaaaggctataaacctagagagccctttctttttagttgcatgccattttctgctgatcaactcaacac |
37710230 |
T |
 |
| Q |
212 |
ggcattatcaaacataa |
228 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
37710229 |
ggcattatcgaacataa |
37710213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 27 - 183
Target Start/End: Complemental strand, 37716384 - 37716228
Alignment:
| Q |
27 |
gtcctcatcatgtggatttggttgctccaatcctaggattatgaccaaacagcaggttgtctttcctcttttt--tagactagttatgcccttgcgtagg |
124 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| || ||||| ||||| | |||||||||||||||| |
|
|
| T |
37716384 |
gtcctcatcatgtggattacgttgctccaaaactaggattatgaccaaacagcaggttgtct---ctttttttcctagaccaagtatgcccttgcgtagg |
37716288 |
T |
 |
| Q |
125 |
g-tggttctagaagatgctcaaaggctataaacctagagagccctttctttttagttgca |
183 |
Q |
| |
|
| | ||||||| | ||||||||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
37716287 |
gtttgttctaggaaatgctcaaatgctataaacctcgagagcactttctttttagttgca |
37716228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University