View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10391_low_23 (Length: 242)
Name: NF10391_low_23
Description: NF10391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10391_low_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 11636338 - 11636114
Alignment:
| Q |
19 |
ccaaatattgaaaataaataaatctgactcttgttttattgtgtggcttttgttctccatcattccctctttcattttgttccgtgtttgctctctctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
11636338 |
ccaaatattgaaaataaataaatctgactcttgttttattgtgtggcttttgttctccatcattccctctttcattttgttcggtgtttgctctttctct |
11636239 |
T |
 |
| Q |
119 |
atgactgatgaattgcgttcatattcacaaaatgtttcggattgtgggctttgattatatgtgggttgaactaaagt-taaaacaatagaatagttttta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11636238 |
atgactgatgaattgcgttcatattcacaaaatgttttggattgtggactttgattatatgtgggttgaactaaagtctaaaacaatagaatagttttta |
11636139 |
T |
 |
| Q |
218 |
aattaatgatatcaattatgatttt |
242 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
11636138 |
aattaatgatatcaattatgctttt |
11636114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 27841101 - 27841159
Alignment:
| Q |
38 |
aaatctgactcttgttttattgtgtggcttttgttctccatcattccctctttcatttt |
96 |
Q |
| |
|
|||| |||| ||||||||||| ||||||||||||||| | || |||||||||||||||| |
|
|
| T |
27841101 |
aaatttgacgcttgttttattttgtggcttttgttcttcttcgttccctctttcatttt |
27841159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University