View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10392_high_20 (Length: 214)
Name: NF10392_high_20
Description: NF10392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10392_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 41640068 - 41640249
Alignment:
| Q |
16 |
taggcaagaattttcattcaacttaaccaaatcaaaggcaaccataaaaactttgaattgtaaatggatgattatgtccacataaaattgaaaagaaaaa |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41640068 |
taggcaagaagtttcattcaacttaaccaaatcaaaggcaaccataaaaactttgaattgtaaatggatgattatgtccacataaaattgaaaagaaaaa |
41640167 |
T |
 |
| Q |
116 |
attgagcaaatattcatttgtttcttaattgtgtgaggcattgtcagtctgtcactaatgtatctctgattatatcaaaatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41640168 |
attgagcaaatattcatttgtttcttaattgtgtgaggcattgtcagtctgtcactaatgtatctctgattatatgaaaatt |
41640249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University