View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10392_low_28 (Length: 248)
Name: NF10392_low_28
Description: NF10392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10392_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 24 - 165
Target Start/End: Complemental strand, 26864696 - 26864553
Alignment:
| Q |
24 |
cggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaacttacnnnnnnnnnn--gtttattaatgattattcttgtca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26864696 |
cggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaacttacttttttttttttgtttattaatgattattcttgtca |
26864597 |
T |
|
| Q |
122 |
tttttaagtttagaaatcacagtcttataatgatgtggatggtc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26864596 |
tttttaagtttagaaatcacagtcttataatgatgtggatggtc |
26864553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University