View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10392_low_28 (Length: 248)

Name: NF10392_low_28
Description: NF10392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10392_low_28
NF10392_low_28
[»] chr4 (1 HSPs)
chr4 (24-165)||(26864553-26864696)


Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 24 - 165
Target Start/End: Complemental strand, 26864696 - 26864553
Alignment:
24 cggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaacttacnnnnnnnnnn--gtttattaatgattattcttgtca 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||    
26864696 cggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaacttacttttttttttttgtttattaatgattattcttgtca 26864597  T
122 tttttaagtttagaaatcacagtcttataatgatgtggatggtc 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
26864596 tttttaagtttagaaatcacagtcttataatgatgtggatggtc 26864553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University