View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10392_low_30 (Length: 242)
Name: NF10392_low_30
Description: NF10392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10392_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 45253362 - 45253585
Alignment:
| Q |
1 |
gttgatatgttgctatgggctattgataaccctgcacctgctaactatttgttaatttctggtgatagagatttctcaaacgctcttcatcaacttcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45253362 |
gttgatatgttgctatgggctattgataaccctgcacctgctaactatttgttaatttctggtgatagagatttctcaaacgctcttcatcaacttcgta |
45253461 |
T |
|
| Q |
101 |
tgagaaggtataacattcttcttgctcaacctttttgtgcttctaaacctcttaccgctgcggcgaaaatcgtttggcaatggcctacactcattgctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45253462 |
tgagaaggtataacattcttcttgctcaacctttttgtgcttctaaacctcttaccgctgcggcgaaaatcgtttggcaatggcctacactcattgctgg |
45253561 |
T |
|
| Q |
201 |
tggtcctcctttcttaactgaacc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45253562 |
tggtcctcctttcttaactgaacc |
45253585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 132
Target Start/End: Complemental strand, 45800259 - 45800155
Alignment:
| Q |
28 |
aaccctgcacctgctaactatttgttaatttctggtgatagagatttctcaaacgctcttcatcaacttcgtatgagaaggtataacattcttcttgctc |
127 |
Q |
| |
|
|||||||||||||| || ||||| || ||||| |||||| |||||||||| || || || |||||||| || ||||| |||||||| |||||||| || | |
|
|
| T |
45800259 |
aaccctgcacctgcgaattatttattgatttcgggtgatcgagatttctctaatgccctccatcaactgcgaatgaggaggtataatattcttctcgcac |
45800160 |
T |
|
| Q |
128 |
aacct |
132 |
Q |
| |
|
||||| |
|
|
| T |
45800159 |
aacct |
45800155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University