View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10392_low_32 (Length: 240)
Name: NF10392_low_32
Description: NF10392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10392_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 29277445 - 29277658
Alignment:
| Q |
18 |
aatacaatggaagaattacagagcaaacagcatactattgataaaaggcttaaaagttggtgtcccaaactcggcacaaattcgaattccccttgctgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29277445 |
aatacaatggaagaattacagagcaaacaacatactattgataaaaggcttaaaagttggtgtcccaaactcagcacaaattcgaattccccttgctgct |
29277544 |
T |
|
| Q |
118 |
tcctgaaaaaggggcaaaatcattaaataatgatatacaataactgtattaagaatgacaccgaggtcgcaaaaagataagaaacctctttgatttcaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29277545 |
tcctgaaaaaggggcaaaatcattaaataatgatatacaataactgtattaagaatgacaccgaggtcgcaaaaagataagaaacctctttgatttcaga |
29277644 |
T |
|
| Q |
218 |
atctttgtctctgc |
231 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
29277645 |
atctttgtcactgc |
29277658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University