View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10393_high_13 (Length: 209)
Name: NF10393_high_13
Description: NF10393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10393_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 36580001 - 36579810
Alignment:
| Q |
1 |
ttgtacaagaatcaaaccaaaagatgatttagattttagaataatcactattaatttttattaaaataataaaaacttttgaacttaaaatcatgtgatt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36580001 |
ttgtacaacaatcaaaccaaaagatgatttagattttagaataatcactattaatttttattaaaataataaaaacttttgaacttaaaatcatgtgatt |
36579902 |
T |
 |
| Q |
101 |
tataattggtaaaattggtttctattaaaggatagataggttgtaagnnnnnnngtgtagagatatttgaaaaatgaagtatgatgcaaagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36579901 |
tataattggtaaaattggtttctattaaaggatagataggttgtaagaaataaagtgtagagatatttgaaaaatgaagtatgatgcaaagg |
36579810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University