View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10393_high_5 (Length: 311)
Name: NF10393_high_5
Description: NF10393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10393_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 154 - 274
Target Start/End: Original strand, 18021464 - 18021584
Alignment:
| Q |
154 |
aatatttttgttcttttctaattgtcattttcaaagttcaaaatatattaaatattgttttctcaaaattacccctaactagctatcgcaaagaaagaat |
253 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
18021464 |
aatatttttgttcttttttaattgtcattttcaaagttcaaaatatattaaatattgttttctcaaaattacccctaaccacctatcgcaaagaaagaat |
18021563 |
T |
 |
| Q |
254 |
agtgaaatgcgataatgaata |
274 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18021564 |
agtgaaatgcgataatgaata |
18021584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University