View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10393_low_13 (Length: 213)
Name: NF10393_low_13
Description: NF10393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10393_low_13 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 22247523 - 22247705
Alignment:
| Q |
15 |
gatgaaagcaacactgtggaaaagaaagaggatgtaagaggttacttcacatggaatttggaaatggagcgtgttttagccgaggcacttagagatcaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22247523 |
gatgaaagcaacactgtggaaaagaaagaggatgtaagaggttacttcacatggaatttggaaatggagcgtgttttagccgaggcacttagagatcaaa |
22247622 |
T |
|
| Q |
115 |
gaagtttgggtcgccagagtgacggagcatggaaagcagtagcatacaatgctgcagctgatgcgttgtctgcacgttttaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22247623 |
gaagtttgggtcgccagagtgacggagcatggaaagcagtggcatacaatgctgcaactgatgcgttgtctgcacgttttaat |
22247705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 36 - 197
Target Start/End: Original strand, 41316023 - 41316184
Alignment:
| Q |
36 |
aagaaagaggatgtaagaggttacttcacatggaatttggaaatggagcgtgttttagccgaggcacttagagatcaaagaagtttgggtcgccagagtg |
135 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||| |||| ||||||| | |
|
|
| T |
41316023 |
aagaaagaggatgcaagagcttacttcacgtggaatttggacatggagcgtgtattagctgaggcacttagagatcaaagaagtatgggccgccagacta |
41316122 |
T |
|
| Q |
136 |
acggagcatggaaagcagtagcatacaatgctgcagctgatgcgttgtctgcacgttttaat |
197 |
Q |
| |
|
||||| |||||| ||| ||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
41316123 |
acggaatttggaaaacagaagcatacaaagctgcagctgatgtgttgtctacacgttttaat |
41316184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 44611920 - 44612099
Alignment:
| Q |
18 |
gaaagcaacactgtggaaaagaaagaggatgtaagaggttacttcacatggaatttggaaatggagcgtgttttagccgaggcacttagagatcaaagaa |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44611920 |
gaaagtaacactgtggaaaagaaagaggatgtacgaggttacttcacgtggaatttggaaatggagcgtgttttagctgaggcacttagagatcaaagaa |
44612019 |
T |
|
| Q |
118 |
gtttgggtcgccagagtgacggagcatggaaagcagtagcatacaatgctgcagctgatgcgttgtctgcacgttttaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||| |||||||||||| |
|
|
| T |
44612020 |
gtttgggtcgccagagtgacggagcatggaaagcagtggcatagaacgctgcagctgatgtgttgtcagcacgttttaat |
44612099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 24 - 197
Target Start/End: Complemental strand, 10158 - 9986
Alignment:
| Q |
24 |
aacactgtggaaaagaaagaggatgtaagaggttacttcacatggaatttggaaatggagcgtgttttagccgaggcacttagagatcaaagaagtttgg |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
10158 |
aacactgtggaaaagaaagaggatgtacgaggttacttcacgtggaatttggaaatggagcgtgttttagctgaggcacttagggatc-aagaagtttgg |
10060 |
T |
|
| Q |
124 |
gtcgccagagtgacggagcatggaaagcagtagcatacaatgctgcagctgatgcgttgtctgcacgttttaat |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
10059 |
gtcgccagagtgatggagcatggaaagcagtggcatacaacgctgcagctgatgtgttgtcagcacgttttaat |
9986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University