View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10393_low_14 (Length: 209)

Name: NF10393_low_14
Description: NF10393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10393_low_14
NF10393_low_14
[»] chr8 (1 HSPs)
chr8 (1-192)||(36579810-36580001)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 36580001 - 36579810
Alignment:
1 ttgtacaagaatcaaaccaaaagatgatttagattttagaataatcactattaatttttattaaaataataaaaacttttgaacttaaaatcatgtgatt 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36580001 ttgtacaacaatcaaaccaaaagatgatttagattttagaataatcactattaatttttattaaaataataaaaacttttgaacttaaaatcatgtgatt 36579902  T
101 tataattggtaaaattggtttctattaaaggatagataggttgtaagnnnnnnngtgtagagatatttgaaaaatgaagtatgatgcaaagg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
36579901 tataattggtaaaattggtttctattaaaggatagataggttgtaagaaataaagtgtagagatatttgaaaaatgaagtatgatgcaaagg 36579810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University