View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10393_low_3 (Length: 365)
Name: NF10393_low_3
Description: NF10393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10393_low_3 |
 |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0020 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 10 - 353
Target Start/End: Complemental strand, 159091 - 158748
Alignment:
| Q |
10 |
agaacctgtgaaatagtcacacaacagaaatgatgagggaattgtttttggttaggaaacaaatgctgagatagggttagaagtgtcaaaaatatcattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
159091 |
agaacctgtgaaatagtcacacaacagaaacgatgagggagttgtttttggttaggaaacaaatgctgagatagggttagaagtgtcaaaaatatcattt |
158992 |
T |
 |
| Q |
110 |
aggatatgcgatctggtcagattatgttgcagaaatatgatcgggaatgtctagacttccggaaaagcgtagaattgtgtaatcctattatatgattctc |
209 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
158991 |
aggatatgcgatctggtcagattgtgttccagaaatatgatcgggaatgtctagacttccggaaaagcgtagaattatgtaatcctattatatgattctc |
158892 |
T |
 |
| Q |
210 |
gaagcacaattattttcctaatatatgattcttgatgttgtctgatcctaaatgcaaatggaaataagattgatgtggattactgcagggaatgtggatt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
158891 |
gaagcacaattattttcctaatatatgattcttgatgttgtcggatcctaaatgcaaatggaaataagattgatgtggattactgcagggaatatggatt |
158792 |
T |
 |
| Q |
310 |
gcattctcctacgacctcatccaatgagatcgacttctgtgctg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
158791 |
gcattctcctacgacctcatccaatgagatcgacttctgtgctg |
158748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University