View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10394_high_2 (Length: 251)
Name: NF10394_high_2
Description: NF10394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10394_high_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 23617409 - 23617661
Alignment:
| Q |
11 |
cagagaatccctaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttccactgcatccaactggcatattggaagggaaatcaa |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23617409 |
cagagaatcctaaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttcctctgcatccaactggcatattggaagggaaatcaa |
23617508 |
T |
|
| Q |
111 |
ctgaccaggtgtcttctagtgtttcagtttcag------------ctgatacacattctggttcttctcatcatgatatcaatcaagatcatggttttaa |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
23617509 |
ctgaccaggtgtcttctattgtttcagtttctgctgatagttccactgatacacattctggttcttctcatcatgagatcaatcaagatcatggttataa |
23617608 |
T |
|
| Q |
199 |
tgggaacaaacccttctttgacttttttaataattctgcaggacaaggttctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23617609 |
tgggaacaaacccttctttgacttttttaataattctgcaggacaaggttctt |
23617661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University