View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10394_low_3 (Length: 324)
Name: NF10394_low_3
Description: NF10394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10394_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 59 - 308
Target Start/End: Complemental strand, 34892748 - 34892519
Alignment:
| Q |
59 |
tcagaggaagtatttattaatgtgtgataaactagannnnnnnnnnnnataatctagnnnnnnnntagagttaaaataacataacnnnnnnngggaatga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
34892748 |
tcagaggaagtatttattaatgtgtgataaactaga--ttttttttttataatctagaaaaaaaatagagttaaaataacataactttttttgggaatga |
34892651 |
T |
|
| Q |
159 |
gttaacatatcaaatcatatgggacgacatttgtcaccaagctttcttataatagaattaatttttgcttaacaaatgcatgtatatctaaatataggtg |
258 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34892650 |
gttaacatatcaaatcatatgggacga-atttgtcactaagctttcttataatagaattaatttttgcttaacaaatgcatgtatatc------------ |
34892564 |
T |
|
| Q |
259 |
ccttataaagattaaaatcttcaacctcaccaaatcattcttcataagat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34892563 |
-----taaagattaaaatcttcaacctcaccaaatcattcttcataagat |
34892519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University