View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10394_low_5 (Length: 290)
Name: NF10394_low_5
Description: NF10394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10394_low_5 |
 |  |
|
| [»] scaffold0591 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 147 - 275
Target Start/End: Original strand, 29645741 - 29645869
Alignment:
| Q |
147 |
cttcatgtatgcaatgcagcttgcaatttctattgcacttcccatggcactccaatgttcaattgatcttggtgtttttgaagtgttgcaaaaagctggt |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29645741 |
cttcatgtatgcaatgcagattgcaatttctattgcacttcccatggcactccaatgtgcaattgatcttggtgtttttgaagtgttgcaaaaagccggt |
29645840 |
T |
 |
| Q |
247 |
aaaggtgctcaactctcggccgacgacat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29645841 |
aaaggtgctcaactctcggccgacgacat |
29645869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 29645602 - 29645671
Alignment:
| Q |
11 |
catagggagataggaatatacacattcaagtcaatatggccagccttttaaattcaaagaatctcaattg |
80 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29645602 |
catagggagataggaatatacacaatcaagtcgatatggccagccttttaaattcaaagaatctcaattg |
29645671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 214 - 269
Target Start/End: Complemental strand, 28731661 - 28731606
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28731661 |
cttggtgtttttgatgtgttgcaaaaagctggtaaaggtgctcaactctctgccga |
28731606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 214 - 269
Target Start/End: Complemental strand, 28626056 - 28626001
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28626056 |
cttggtgtatttgatgtgttgcaaaaagctggtaaaggtgctcaactctctgccga |
28626001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 214 - 269
Target Start/End: Complemental strand, 28701070 - 28701015
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28701070 |
cttggtgtatttgatgtgttgcaaaaagctggtaaaggtgctcaactctctgccga |
28701015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 269
Target Start/End: Complemental strand, 28711996 - 28711917
Alignment:
| Q |
190 |
atggcactccaatgttcaattgatcttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
||||||||||| | | ||| ||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28711996 |
atggcactccattctgcaactgagcttggtgtatttgatgtgttgcaaaaagctggcaaaggtgctcaactctctgccga |
28711917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 269
Target Start/End: Complemental strand, 28719343 - 28719264
Alignment:
| Q |
190 |
atggcactccaatgttcaattgatcttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
||||||||||| | | ||| ||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28719343 |
atggcactccattctgcaactgagcttggtgtatttgatgtgttgcaaaaagctggcaaaggtgctcaactctctgccga |
28719264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 269
Target Start/End: Complemental strand, 28726985 - 28726906
Alignment:
| Q |
190 |
atggcactccaatgttcaattgatcttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
||||||||||| | | ||| ||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28726985 |
atggcactccattctgcaactgagcttggtgtatttgatgtgttgcaaaaagctggcaaaggtgctcaactctctgccga |
28726906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 176 - 269
Target Start/End: Complemental strand, 28636854 - 28636761
Alignment:
| Q |
176 |
ctattgcacttcccatggcactccaatgttcaattgatcttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
||||||| |||| |||||||| |||| | ||| ||| |||||||||||||| || |||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
28636854 |
ctattgcgtttccaatggcactacaatctgcaactgagcttggtgtttttgatgttttgcaaaaagctggaaaagatgctcaactctctgccga |
28636761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 269
Target Start/End: Complemental strand, 28644550 - 28644495
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
28644550 |
cttggtgtatttgatgtgttgcaaaaaactggtaaaggtgctcaactctctgccga |
28644495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 263
Target Start/End: Complemental strand, 28740600 - 28740551
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctc |
263 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
28740600 |
cttggtgtatttgatgtgttgcaaaaagctggtaaagatgctcaactctc |
28740551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0591 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0591
Description:
Target: scaffold0591; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 214 - 269
Target Start/End: Original strand, 5228 - 5283
Alignment:
| Q |
214 |
cttggtgtttttgaagtgttgcaaaaagctggtaaaggtgctcaactctcggccga |
269 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5228 |
cttggtgtatttgatgtgttgcaaaaagctggtaaaggtgctcaactctctgccga |
5283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University