View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10395_high_3 (Length: 301)
Name: NF10395_high_3
Description: NF10395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10395_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 296
Target Start/End: Complemental strand, 10499161 - 10498886
Alignment:
| Q |
17 |
caaatcattgggtcaattttcatatcccattataataacattgttcatatttgcatagatatggttttcaaaatgcaaatgaatttggcacattttatca |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
10499161 |
caaatcattgggacaattttcatatcccattataataacattgttcatatttgcatagatatggttttcaatatgc----gcatttggcacattttatca |
10499066 |
T |
 |
| Q |
117 |
tgtctgtcaaagagaaactcagctgttggtttctgtatataattaagcgccgccaaaaaagtagtactagttcaatagctaaaaaatattatagagatgc |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10499065 |
tgtctgtcaaagagaaactcagttgttggtttctgtatataattaagcgcctccaaaaaaatagtactagttcaatagctaaaaaaaattatagagatgc |
10498966 |
T |
 |
| Q |
217 |
aaaccagcatttcttctttgggtgtgaggttgctccccatctcggggtgttccttccttatccaagtatcctatgctact |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10498965 |
aaaccagcatttcttctttgggtgtgaggttgctccccatcttggggtgttccttccttatccaagtatcctatggtact |
10498886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University