View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10395_low_12 (Length: 239)
Name: NF10395_low_12
Description: NF10395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10395_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 36779685 - 36779478
Alignment:
| Q |
12 |
cgagtaaatagcacattactactatttgtatttgtagatcctcgtgtcattccaattagattgtgtcaacgtggtaatgtaccatgggaacttgagcgca |
111 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779685 |
cgagtaaataacacattactgctatttgt---tgtagatcctcgtgtcattccaattagattgtgtcaacgtggtaatgtaccatgggaacttgagcgca |
36779589 |
T |
 |
| Q |
112 |
atgtgtcatttggtaggaacttgaccatactatctttcagagtaaatagtttgttgaagaacatttttagatggttatgtagaattaatcataagttttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779588 |
atgtgtcatttggtaggaacttgaccatactatctttcagagtaaatag-ttgttgaagaacatttttagatggttatgtagaattaatcataagttttt |
36779490 |
T |
 |
| Q |
212 |
aatggtcgcaag |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36779489 |
aatggtcgcaag |
36779478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University