View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10395_low_17 (Length: 206)
Name: NF10395_low_17
Description: NF10395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10395_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 33488462 - 33488277
Alignment:
| Q |
1 |
tgaccaagattatttcatctcactatctcatacaaagtactcttgcacataagtttggtagcatgacttggtggtttgagggggtgtatatataagttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33488462 |
tgaccaagattatttcatctcactatctgatacaaagtactcttgcacataagtttggtagcatgacttggtggtttgagggggtgaatatataagttga |
33488363 |
T |
|
| Q |
101 |
agtaaaaatgatgttgtggattcaactcccc-aaagtataatactccatctaacaaccactatttaatagttagactattactttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
33488362 |
agtaaaaatgatgttgtggattcaactccccaaaagtataatactccatctaacacctactatttaatatttagactattactttt |
33488277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University