View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10396_high_24 (Length: 227)

Name: NF10396_high_24
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10396_high_24
NF10396_high_24
[»] chr7 (1 HSPs)
chr7 (10-207)||(30436406-30436603)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 30436603 - 30436406
Alignment:
10 gagatgaagaggaatatggcgataaatgtttgtgattcgtcacacttatcggctcctgattctctttttaccgaacatcctgcagcttcagactctatct 109  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
30436603 gagatgaagaggaatatggcgataaatgtttgtgagtcgtcacacttatcagctcctgattctctttttaccgaacatcctgcagcttcagactctatct 30436504  T
110 tgtggaaatctggcaataaccaatttcagctgcaaccaagatagagtcgtgcttgcgagccatgtggatttcaaaatttctttgagcgactcctcgtg 207  Q
    |||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
30436503 tgtggaaaactggcaataaccaatttcagatgcaaccaagatagagtcgtgcgtgcgagccatgtggatttcaaaatttctttgagcgactcctcgtg 30436406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University