View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_high_24 (Length: 227)
Name: NF10396_high_24
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 30436603 - 30436406
Alignment:
| Q |
10 |
gagatgaagaggaatatggcgataaatgtttgtgattcgtcacacttatcggctcctgattctctttttaccgaacatcctgcagcttcagactctatct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30436603 |
gagatgaagaggaatatggcgataaatgtttgtgagtcgtcacacttatcagctcctgattctctttttaccgaacatcctgcagcttcagactctatct |
30436504 |
T |
 |
| Q |
110 |
tgtggaaatctggcaataaccaatttcagctgcaaccaagatagagtcgtgcttgcgagccatgtggatttcaaaatttctttgagcgactcctcgtg |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30436503 |
tgtggaaaactggcaataaccaatttcagatgcaaccaagatagagtcgtgcgtgcgagccatgtggatttcaaaatttctttgagcgactcctcgtg |
30436406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University