View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_low_10 (Length: 403)
Name: NF10396_low_10
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_low_10 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 135 - 403
Target Start/End: Complemental strand, 12820897 - 12820630
Alignment:
| Q |
135 |
gcacgttcagtttccagtgtcataacttttccactgaatcatctactagaaaacccctcattgatcactgtggacagcgactgttacaaacgactcgagt |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
12820897 |
gcacgttcagtttccagtgtcgtaacttttccactgaatcgtctactagaaaacccctcattgatcaccgtcgacagcgactgttacaaac-actcgagt |
12820799 |
T |
 |
| Q |
235 |
ttaataacttcacccgaatggttggttcatgtaatggattgctatgtttgtttggtacttctaacacaactgagcatcaaaactactggttccatatctg |
334 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12820798 |
ttaataatttcacccgaatggttggttcatgtaatggattgctatgtttgtttggtagttctaacacaactgaatatcaaaactactggttccatatctg |
12820699 |
T |
 |
| Q |
335 |
gaacccagccactaggaaaatatctgaaagattatgatcttttcaccaacccctaaagcctgtaagtgc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
12820698 |
gaacccagccactaggaaaatatctgaaagattaggatcttttcaccgaccccgaaagcttgtaagtgc |
12820630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 19638060 - 19638001
Alignment:
| Q |
21 |
tgtgtctgcaagtcatggaacacactcatctcttccgatcccactttcgtcaaattgcacctt |
83 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
19638060 |
tgtgtctgcaagtcatggaaaaccatcatctct---gatcccacttttgtcaaattacacctt |
19638001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 320 - 385
Target Start/End: Original strand, 29641889 - 29641954
Alignment:
| Q |
320 |
ctggttccatatctggaacccagccactaggaaaatatctgaaagattatgatcttttcaccaacc |
385 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| |||||| |||| |||| || ||| ||||||||| |
|
|
| T |
29641889 |
ctggttccgtatctggaacccagccacaaggataatatcggaaaaattaggaacttgtcaccaacc |
29641954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 358
Target Start/End: Complemental strand, 29821143 - 29821105
Alignment:
| Q |
320 |
ctggttccatatctggaacccagccactaggaaaatatc |
358 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
29821143 |
ctggttccagatctggaacccagccactaggataatatc |
29821105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University