View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_low_14 (Length: 368)
Name: NF10396_low_14
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 199 - 353
Target Start/End: Original strand, 47190589 - 47190743
Alignment:
| Q |
199 |
tgtaatctgttacgaaagttgatactgacaaagctctaggcaagcgagctgctgtggagttggtgcaatagctggcttttgatcaagttgtgctctacca |
298 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47190589 |
tgtaatctgttacgaaagttgatattgacaaagctctaggcaagcgagctgctgtggagttggtgcaatagctggcttttgatcaagttgtgctctacca |
47190688 |
T |
|
| Q |
299 |
ggattcnnnnnnngtagtagatgctttcaactcagatgtgcaagatagatgacac |
353 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47190689 |
ggattcaaaaaaagtagtagatgctttcaactcagatgtgcaagatagatgacac |
47190743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 47190481 - 47190593
Alignment:
| Q |
19 |
cagatacagcagatgctaaaacaatgtgaatgta-cctattatgacagtgggaatgtaacttgttaaaacagtgccaacaataaagtttaacttcaaata |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47190481 |
cagatacagcagatgccaaaacaatgtgaatgtaacctattatgacagtgggaatgtaacttgttaaaacagtgccaacaataaagtttaacttcaaata |
47190580 |
T |
|
| Q |
118 |
agatcaagtgtaa |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47190581 |
agatcaagtgtaa |
47190593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University